What Does It Mean When You Dont Have Enough Fetal Fragments to Determine What Is the Sex of the Baby

Avicenna J Med Biotechnol. 2011 Oct-Dec; 3(four): 201–206.

Fetal Sex Determination using Not-Invasive Method of Cell-free Fetal Dna in Maternal Plasma of Pregnant Women During half dozen^th– 10^th Weeks of Gestation

Maryam Zargari

ⁱBiology Department, Science and Research Co-operative, Islamic Azad University (IAU), Tehran, Iran

Mohammad Reza Sadeghi

²Reproductive Biotechnology Research Eye, Avicenna Inquiry Constitute, ACECR, Tehran, Iran

Mohammad Hassan Shahhosseiny

^threeMicrobiology Department, Shahr-east-Qods Branch, Islamic Azad University (IAU), Tehran, Islamic republic of iran

Koroush Kamali

^fourReproductive Biotechnology Research Centre, Avicenna Research Constitute, ACECR, Tehran, Iran

Kyomars Saliminejad

⁴Reproductive Biotechnology Enquiry Middle, Avicenna Research Found, ACECR, Tehran, Islamic republic of iran

Ali Esmaeilzadeh

^ivReproductive Biotechnology Research Centre, Avicenna Enquiry Found, ACECR, Tehran, Iran

Hamid Reza Khorram Khorshid

⁴Reproductive Biotechnology Research Centre, Avicenna Research Institute, ACECR, Tehran, Islamic republic of iran

^vGenetic Research Centre, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran

Received 2011 Oct 9; Accepted 2011 Nov 26.

Abstract

In previous years, identification of fetal cells in maternal blood circulation has caused a new revolution in non-invasive method of prenatal diagnosis. Depression number of fetal cells in maternal claret and long-term survival afterward pregnancy limited the use of fetal cells in diagnostic and clinical applications. With the discovery of jail cell-complimentary fetal Deoxyribonucleic acid (cffDNA) in plasma of pregnant women, access to genetic cloth of the fetus had become possible to determine early gender of a fetus in pregnancies at the adventure of X-linked genetic conditions instead of applying invasive methods. Therefore in this study, the probability of detecting sequences on the Y chromosome in pregnant women has been evaluated to identify the gender of fetuses. Peripheral blood samples were obtained from 80 pregnant women at 6^th to 10^thursday weeks of gestation and then the fetal Dna was extracted from the plasma. Nested PCR was practical to detect the sequences of single copy SRY gene and multi copy DYS14 & DAZ genes on the Y chromosome of the male fetuses. At the cease, all the obtained results were compared with the actual gender of the newborns. In 40 out of 42 born infant boys, the relevant cistron sequences were identified and 95.2% sensitivity was obtained. Not-invasive early determination of fetal gender using cffDNA could be employed every bit a pre-test in the shortest possible time and with a loftier reliability to avert applying invasive methods in cases where a fetus is at the risk of genetic diseases.

Keywords: Fetus, Genetic cloth, Prenatal diagnosis, Sexual practice determination

Introduction

Traditionally, early fetal gender determination has been performed using invasive techniques, such as chorionic villus sampling or amniocentesis. These procedures, however, still comport a risk of miscarriage around 1-2% and cannot be performed until 11 weeks of gestation (i). Also, reliable determination of fetal sex by means of ultrasonography cannot exist done in the outset trimester considering of uncompleted development of the external ballocks (two).

Therefore, more efforts have been spent in developing prenatal diagnostic procedures that do not institute a risk for the fetus, based on the analysis of fetal genetic fabric obtained from the fetal cells circulating in maternal blood (3, 4). Substantial advances have been made in the enrichment and isolation of fetal cells for analysis, but about techniques are time-consuming or require expensive equipment. In addition, these cells are very rare in maternal plasma (one fetal prison cell per 10^six maternal cells) and they are unlikely to persist after commitment, including subsequent pregnancies (5, 6). Further studies on neoplasm derived DNAs in the plasma of cancer patients open the possibility that fetal Deoxyribonucleic acid which originated from apoptotic trophoblasts of the placenta, may also be found in maternal plasma (seven, 8). Finally with the discovery of prison cell-costless fetal DNA (cffDNA) fragments in the plasma of pregnant women carrying male person fetus in 1997, reliable and accurate diagnosis became reality (nine).

More studies revealed that the concentration of fetal Dna in maternal plasma was found to be much college than that nowadays in the cellular fraction (25.4 GEq/ml in early on stage of pregnancy and 292.2 GEq/ml in late stage of pregnancy) (x) and the post-partum clearance of cffDNA from the maternal apportionment was rapid with a mean one-half-life of 16.3 min (xi). Also, fetal Deoxyribonucleic acid molecules are mostly shorter than maternal Dna molecules (between 193 bp to 313 bp). Therefore, it tin be distinguished from the maternal Deoxyribonucleic acid past size separation (12). These findings have provided the opportunity to perform reliable genetic testing on cffDNA extracted from the maternal plasma at an early stage in pregnancy without interference from previous pregnancies for non-invasive prenatal diagnosis of paternally inherited disorders as well every bit fetal gender conclusion.

Using cffDNA in maternal plasma for fetal gender determination is mainly limited to those sequences which are absent from the maternal genome such as the SRY, DYS14 and DAZ that are located on the Y chromosome. Therefore, the only way to identify these sequences is through male-bearing pregnancies (13).

In this report, early determination of fetal gender using cffDNA can exist considered as a non-invasive pre-test to decide whether invasive prenatal diagnosis should exist performed on a fetus having a hazard of X-linked disorders or not. Thus, invasive procedures can be avoided when the fetus is known to be female person at an early gestational historic period, while prenatal diagnosis might exist performed only for male fetuses. To achieve this goal, the post-obit study using cffDNA in maternal plasma was performed on pregnant women during their half-dozen^th -10^th weeks of pregnancy to obtain the required sensitivity, specificity and accurateness for a not-invasive prenatal examination.

Materials and Methods

Sample drove

Peripheral blood samples were obtained from 80 pregnant women at their six^th to 10^th weeks of gestation who were referred to Avicenna Infertility Dispensary in Tehran, Iran during 2009-2010. Likewise in this study, 5 not-meaning women and five men were considered as a negative and positive control. Before blood sampling, signed consent forms were obtained from all participants and the protocol of the written report was approved by the ideals committee of Avicenna inquiry institute. For each case, 5 ml peripheral blood was collected in a tube containing 200 µl of 0.5 Yard EDTA and immediately stored at four°C. Inside 24 hr after collection, blood samples were centrifuged at 3000 m for x min and the upper plasma layer was advisedly removed without agonizing the buffy coat, transferred into a new Eppendorf tube for storage at -20°C until further processing.

Deoxyribonucleic acid Extraction

Genomic DNA was extracted from 200 µl of the plasma samples using the QIAamp Deoxyribonucleic acid Claret Mini kit (Qiagen, USA) every bit recommended past the manufacturer co-ordinate to the manufacturer's "Blood and Body Fluid" protocol. The extracted Dna was eluted in fifty µl of the elution buffer.

Primers

Due to the low concentration of cffDNA in maternal plasma, multicopy DAZ and DYS14 genes were used for detection of sequences on the Y chromosome in male-bearing pregnancies. As well, sequence of single re-create SRY gene was used as an internal control of gender conclusion. In order to assess the presence of sufficient cell-free Deoxyribonucleic acid in an extraction, analysis of the ACTB sequences was performed. All the pairs of primers were designed by using the Primer3 and Gene Runner software (Table 1).

Table 1

Primer sequences used in PCR

	Primer proper name	Sequence (5' → 3')		Primer name	Sequence (v' → 3')
First round of PCR	SRY	Frontwards: TACAGGCCATGCACAGAGAG	2d round of PCR	SRY	Forward: AGTATCGACCTCGTCGGAAG
		Opposite: TCTTGAGTGTGTGGCTTTCG			Opposite: TCTTGAGTGTGTGGCTTTCG
	DYS14	Forrard: AGCCCTGATCACTGACGAAG		DYS14	Forward: AGGAAGACTGGGGCTAGAGG
		Reverse: TGCAGAGATGAACAGGATGC			Reverse: ACCTGTCAGGACAAGGTGGA
	DAZ	Forrad: TACCTCCAAAGCACCAGAGC		DAZ	Forward: TACCTCCAAAGCACCAGAGC
		Opposite: AATCTACCCATTCCCGAACC			Reverse: TGAGGAGGCATCTGGAAATC
	ACTB	Forward: GATGGTGGGCATGGGTCAGAAGGA
		Contrary: CATTGTAGAAGGTGTGGTGCCAGAT

Nested PCR

The fetal sex was identified past nested PCR technique to amplify the DYS14 and DAZ sequences, whereas the semi-nested PCR was used for amplification of SRY sequences. In the first round of PCR, the amplification reactions were set in a total volume of 25 µl containing: 2 µL of 10 ng genomic Deoxyribonucleic acid, two.five µL of 10X PCR buffer (Roch, Frg), ane µl of 10 mM dNTPs, 10 pmol of each primers, i unit of Taq Deoxyribonucleic acid polymerase (Roch, Germany), 2.5 µl of Mgcl₂ (for SRY and DAZ) and a three µl of Mgcl₂ for DYS14. Distension was performed using a programmable thermal cycler gradient PCR system (Eppendorf, Federal republic of germany) with an initial denaturation of 94°C for 5 min followed by xl cycles of denaturation at 94°C for thirty sec, annealing at 62°C for xxx sec (for SRY, DYS14) and 64°C (for DAZ), extension at 72°C for 30 sec and the last extension at 72°C for x min.

One µl of the PCR products were used as template for the second round of PCR. The reaction system and thermo-cycling status were the same as those of the first round of PCR just they were carried out in 35 cycles. At the end of each round of PCR, amplification products were visualized past staining with ethidium bromide later on electrophoresis on 2% agarose gel. To recognize contamination, a non template control, containing DNA free h2o was also added in each reaction.

Anti-contamination measures

As an anti-contagion measure, an aerosol resistant pipette tips were used for all liquids and separate areas were considered for all the steps of the analysis. In social club to eliminate contact with exogenous male DNA, merely female operators were selected in all procedures using a laminar menses hood.

Statistical analysis

At the end, all the obtained results were compared with the bodily gender of the new-borns to calculate the sensitivity, specificity and accuracy of the applied method. Kappa coefficient of agreement was calculated to evaluate the precision and definiteness of the method and for evaluation of the clinical application, parameters such equally Positive Predictive Value (PPV) and Negative Predictive Value (NPV) were as well analysed. Statistical assay was performed using the SPSS statistical bundle (5.11.five).

Results

Statistical analysis of the data showed that from the total of 80 samples obtained from pregnant women with age range of xviii to 46 years (mean historic period=xxx.36) and pregnancy week range from 6 to 10 weeks (hateful week=vii.74), abortion was observed in 5 cases. Although the gender decision tests were conducted on these v samples, they were excluded from statistical assay due to lack of knowledge of the bodily fetal gender to compare with exam results. Also, among the 80 samples, sixteen cases with multiple gestations (nine identical twins, 6 non-identical twins and 1 triplet) were observed which were included in our statistical analysis.

Nested PCR results

In all the obtained samples, ACTB sequences were amplified (PCR product length=149 bp) indicating the presence of sufficient DNA in the extracted samples (Figure 1A). Regarding the SRY, DYS14 and DAZ sequences, no positive bands of PCR were observed in samples during the first round of PCR. Still, on the electrophoresis results of the second round of PCR (Figures 1B, ​ C, and ​ D), positive bands (PCR product length=143 bp, 122 bp and 156 bp, respectively) were observed for each SRY, DYS14 and DAZ sequences in xl samples similar to positive control DNA sample which was recorded every bit positive, and every bit a issue the male gender. On the other hand, in the absenteeism of positive bands of PCR for 2 or 3 of the mentioned sequences in fetal samples similar to negative control Deoxyribonucleic acid sample. These were considered as negative and would represent the female gender. It should exist mentioned that in all the 40 samples classified as male fetuses all the 3 mark targets were positive.

The agarose gel electrophoresis event of ACTB (A), SRY (B), DYS14 (C) and DAZ (D) distension past nested PCR analysis in fetal Deoxyribonucleic acid samples extracted from the maternal plasma. Lanes one & 2: Fetal DNA, Lane 3: Male DNA as a positive control, Lane 4: non pregnant women DNA as a negative control and Lane 5: PCR reaction negative Control (Water). A) 149 bp Positive bands in lane i and 2 point the presence of sufficient DNA in the extracted samples. Observation of positive bands 143 bp B) 122 bp C) and 156 bp D) in lane 2 shows the amplification of the relevant genes and indicate that the gender of the fetus is male. The absence of positive band in lane 1 indicates the female person gender of the fetus

Comparing of the obtained results with the actual birth outcome indicates that from l infant girls born, 49 fetal genders were correctly diagnosed and only in ane example, positive result was obtained. Too from 42 baby boys born, 40 genders were correctly diagnosed past using the SRY, DYS14 and DAZ sequences (Table 2).

Tabular array 2

Comparison of test results by nested PCR with the actual birth result in fourscore samples during 6^th to 10^thursday weeks of gestation

Gestational historic period	Result at nascency	Result past Nested PCR
		Female	Male
6 Weeks	Female	4	1 a
	Male	0	seven
Total Gender at Birth		5	seven
vii Weeks	Female	fourteen	0
	Male person	2 b	7
Total Gender at Birth		fourteen	nine
8 Weeks	Female	20	0
	Male person	0	xx
Total Gender at Birth		20	20
9 Weeks	Female	viii	0
	Male	0	four
Full Gender at Birth		eight	4
10 Weeks	Female	3	0
	Male person	0	two
Total Gender at Nascence		3	2
Total sensitivity of the test		95.two% (95% CI= 0.842 to 0.987)
Full specificity of the examination		98.0% (95% CI= 0.895 to 0.996)

The sensitivity and specificity of the method used in fetal gender determination (with 95% conviction intervals) were respectively 95.2% (95% CI= 0.842 to 0.987) and 98% (95% CI= 0.895 to 0.996). Kappa coefficient of agreement in relevant test is 0.934 and the p-values=0.001 were considered statistically pregnant in each analysis using SRY, DYS14 and DAZ sequences. The PPV and NPV of the method used respectively were 97.6% (95% CI= 0.895-0.996) and 96.1% (95% CI=0.868-0.989).

Discussion

In recent years, the existence of circulating fetal prison cell-gratis DNA in maternal blood which was discovered by Lo et al in 1997, created an outstanding revolution in not-invasive prenatal diagnosis. Fetal nucleic acids can exist obtained from a unproblematic blood draw of the mother that is risk-free and highly toll effective compared to conventional invasive methods. Despite the low concentration of cffDNA (3.4% to 6.ii% of total maternal DNA) and with the advent of molecular techniques such equally Polymerase Chain Reaction (PCR), nucleic acid based testing has get a valuable source for not-invasive prenatal diagnosis since nucleic acids can be amplified (10). Therefore, in this report by using nested PCR technique, 95.two% sensitivity was achieved in identification of male fetuses using SRY, DYS14 and DAZ sequences. This is very close to the sensitivity obtained in previous studies. And in almost cases, fifty-fifty significantly college sensitivity was obtained.

Previous investigations accept shown sensitivity of 94% (Smid et al, 1999), 96% (Al Yatama et al, 2001), 94% (Zolotukhina et al, 2005) and 88.2% (Hong et al, 2006) (xiv–17). However in these findings, longer fourth dimension range of pregnancy were considered, which led to high probability of identifying cffDNA because of the gradual increase of its concentration with increasing gestational historic period (eighteen). In comparison, the results obtained in this report in the 6^th to ten^th weeks of pregnancy led to significantly meliorate results.

Overall, the differences observed between the results of the previous studies and this report can be explained through the apply of different methods of fetal DNA extraction, depression concentration of cffDNA at an early gestational historic period, number of population, fourth dimension range of the pregnancy and existence of potential contamination.

In this study, false positive consequence was observed only in one instance that gender of female fetus, which was at the historic period of six weeks, was diagnosed as a male. Citing the theory of vanishing twins within the first 7 weeks of gestation in 0.3-0.7% of pregnancies (19), it tin can exist concluded that during the fourth dimension of sampling in the 6^th calendar week of gestation, there was a male person twin that disappeared in the subsequent weeks of pregnancy and only the babe girl was born.

On the other paw, faux negative results were obtained in two cases of pregnancies with non-identical twins which can be the result of extraction failure of the male twin DNA compared to the female person twin due to its low concentration of cffDNA. Therefore if nosotros do not consider multiple gestations in our study, we accept reached a significant 100% sensitivity.

In comparing between total numbers of fetuses that were correctly diagnosed and total numbers of infant born, 96.seven% accuracy was achieved in fetal gender determination. Also according to the Kappa coefficient of agreement, which is in "almost perfect" understanding range between 0.81 and 0.99 (20), it can be concluded that the results are remarkably consequent with the actual gender of the babies.

To check whether the method used in this study is suitable for clinical awarding or not, the parameters of PPV and NPV were calculated. The PPV and NPV indicate that if the test results are positive and the fetus is diagnosed every bit a male child, there is 97.6% probability to exist a boy and 96.one% probability to be a girl if the exam results are negative. Therefore, this method can be used every bit a clinical method in determining the fetal gender due to its high probability of correct prediction, prior to applying invasive methods.

Conclusion

Nosotros hope that non-invasive fetal gender determination using cffDNAs in maternal plasma would allow us to obtain an early knowledge of the fetal sex and adding to timely clinical management. This could reduce the need for invasive procedures in pregnant women carrying an 10-linked disorder up to 50%. Also, hopefully in the near future, this method can be applied as a diagnostic tool for diseases of pregnancy such every bit pre-eclampsia or preterm labor, or for fetal anomalies such as aneuploidies.

Acknowledgement

We would like to thank all of the individuals who kindly accepted to participate in this study. Also, nosotros are securely indebted to the personnel of Avicenna Infertility Dispensary for their help in sample collection and to Ms. H. Edalatkhah for their helpful advices. Financially, this report was supported by Avicenna Research Institute.

References

1. Brandenburg H, Jahoda MG, Pijpers L, Reuss A, Kleyer WJ, Wladimiroff JW. Fetal loss charge per unit later chorionic villus sampling and subsequent amniocentesis. Am J Med Genet. 1990;35(2):178–180. [PubMed] [Google Scholar]

2. Odeh M, Granin 5, Kais Yard, Ophir E, Bornstein J. Sonographic fetal sex determination. Obstet Gynecol Surv. 2009;64(ane):l–57. [PubMed] [Google Scholar]

iii. Simpson JL, Elias Southward. Isolating fetal cells in maternal circulation for prenatal diagnosis. Prenat Diagn. 1994;14(13):1229–1242. [PubMed] [Google Scholar]

4. Bianchi DW, Flintstone AF, Pizzimenti MF, Knoll JH, Latt SA. Isolation of fetal DNA from nucleated erythrocytes in maternal blood. Proc Natl Acad Sci USA. 1990;87(nine):3279–3283. [PMC costless commodity] [PubMed] [Google Scholar]

5. Hamada H, Arinami T, Kubo T, Hamaguchi H, Iwasaki H. Fetal nucleated cells in maternal peripheral blood: frequency and relationship to gestational age. Hum Genet. 1993;91(5):427–432. [PubMed] [Google Scholar]

6. Hamada H, Arinami T, Hamaguchi H, Kubo T. Fetal nucleated cells in maternal peripheral blood after delivery. Am J Obstet Gynecol. 1994;170(four):1188–1193. [PubMed] [Google Scholar]

7. Chen XQ, Stroun M, Magnenat JL, Nicod LP, Kurt AM, Lyautey J, et al. Microsatellite alterations in plasma DNA of pocket-size cell lung cancer patients. Nat Med. 1996;2(9):1033–1035. [PubMed] [Google Scholar]

8. Alberry Thousand, Maddocks D, Jones M, Abdel Hadi Chiliad, Abdel-Fattah Southward, Avent N, et al. Free fetal DNA in maternal plasma in anembryonic pregnancies: confirmation that the origin is the trophoblast. Prenat Diagn. 2007;27(5):415–418. [PubMed] [Google Scholar]

9. Lo YM, Corbetta N, Chamberlain PF, Rai V, Sargent IL, Redman CW, et al. Presence of fetal DNA in maternal plasma and serum. Lancet. 1997;350(9076):485–487. [PubMed] [Google Scholar]

x. Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, et al. Quantitative analysis of fetal Deoxyribonucleic acid in maternal plasma and serum: implications for not invasive prenatal diagnosis. Am J Hum Genet. 1998;62(4):768–775. [PMC free commodity] [PubMed] [Google Scholar]

11. Lo YM, Zhang J, Leung TN, Lau TK, Chang AM, Hjelm NM. Rapid clearance of fetal Deoxyribonucleic acid from maternal plasma. American journal of human genetics. Am J Hum Genet. 1999;64(1):218–224. [PMC costless article] [PubMed] [Google Scholar]

12. Li Y, Zimmermann B, Rusterholz C, Kang A, Holzgreve W, Hahn S. Size separation of circulatory DNA in maternal plasma permits ready detection of fetal DNA polymorphisms. Clin Chem. 2004;fifty(6):1002–1011. [PubMed] [Google Scholar]

13. Wright CF, Burton H. The employ of cell-complimentary fetal nucleic acids in maternal blood for non-invasive prenatal diagnosis. Hum Reprod Update. 2009;15(1):139–151. [PubMed] [Google Scholar]

fourteen. Al-Yatama MK, Mustafa Every bit, Ali S, Abraham S, Khan Z, Khaja N. Detection of Y chromosome-specific Deoxyribonucleic acid in the plasma and urine of meaning women using nested polymerase concatenation reaction. Prenat Diagn. 2001;21(5):399–402. [PubMed] [Google Scholar]

15. Hong P, Zhu PY, Huang YF, Luan JF. Written report on fetal SRY factor in maternal plasma using nested polymerase chain reaction. Zhonghua Nan Ke Xue. 2006;12(4):333–336. [PubMed] [Google Scholar]

xvi. Smid 1000, Lagona F, de Benassuti L, Ferrari A, Ferrari G, Cremonesi L. Evaluation of different approaches for fetal Deoxyribonucleic acid assay from maternal plasma and nucleated blood cells. Clin Chem. 1999;45(9):1570–1572. [PubMed] [Google Scholar]

17. Zolotukhina Boob tube, Shilova NV, Voskoboeva EY. Analysis of cell-costless fetal Deoxyribonucleic acid in plasma and serum of pregnant women. J Histochem Cytochem. 2005;53(3):297–299. [PubMed] [Google Scholar]

18. Horinek A, Korabecna M, Panczak A, Gallova ZU, Nouzova Thousand, Calda P, et al. Cell-complimentary fetal Dna in maternal plasma during physiological single male person pregnancies: Methodology issues and kinetics. Fetal Diagn Ther. 2008;24(1):xv–21. [PubMed] [Google Scholar]

19. Landy HJ, Keith LG. Hum Reprod Update. 1998;4(ii):177–183. [PubMed] [Google Scholar]

twenty. Viera AJ, Garrett JM. Understanding interobserver agreement: the kappa statistic. Fam Med. 2005;37(five):360–363. [PubMed] [Google Scholar]

eastmanolike1957.blogspot.com

Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3558193/

Share this post